Logo2

Quiz Βιολογία Γ’ Λυκείου (1)

Welcome to your Βιολογία Γ' Λυκείου

Ένα μονόκλωνο μόριο άγνωστης ταυτότητας παρουσιάζει μερικό ζευγάρωμα των αζωτούχων βάσεών του και ικανότητα πρόσδεσης στο ριβόσωμα. Το μόριο αυτό είναι ένα:
Κατά τον σχηματισμό ωαρίου συμβαίνει μη διαχωρισμός χρωμοσωμάτων του 21ου χρωμοσώματος στην 1η μειωτική διαίρεση. Ωάριο από αυτή τη μείωση γονιμοποιείται από φυσιολογικό σπερματοζωάριο. Η πιθανότητα το παιδί που θα γεννηθεί να πάσχει από σύνδρομο
Γενετική ανάλυση στα χρωμοσώματα ανθρώπου έδειξαν πως στο ίδιο χρωμόσωμα συνυπάρχουν γονίδια του παππού του και της γιαγιάς του (απ την πλευρά της μητέρας του.) Δώστε μιά εξήγηση αιτιολογώντας την απάντησή σας.
Η παρακάτω αλληλουχία ανήκει σε μόριο tRNA, snRNA, mRNA, rRNA: ΑΑCGAAACGAAAGAACCACCGUUUCAAC

Μοιραστειτε το περιεχομενο

Share on facebook
Share on twitter
Share on linkedin
Share on pinterest
Share on email